ID: 1171346782_1171346789

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1171346782 1171346789
Species Human (GRCh38) Human (GRCh38)
Location 20:24471160-24471182 20:24471182-24471204
Sequence CCCCAGAGCCGGCCAACTTCTCC CGTGCTAGGCTGCGACCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 147} {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!