ID: 1172071274_1172071279

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1172071274 1172071279
Species Human (GRCh38) Human (GRCh38)
Location 20:32259149-32259171 20:32259201-32259223
Sequence CCTGCTTTACCCATAAAGGCAAT TTGCCCAGGCTGAAGTGCAGTGG
Strand - +
Off-target summary No data {0: 2064, 1: 73654, 2: 183538, 3: 230183, 4: 188187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!