ID: 1172163580_1172163585

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1172163580 1172163585
Species Human (GRCh38) Human (GRCh38)
Location 20:32885269-32885291 20:32885288-32885310
Sequence CCGCCTCATATCAGCTTCTACGT ACGTGGGGCCCTTTTTCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 98} {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!