ID: 1172357905_1172357917

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1172357905 1172357917
Species Human (GRCh38) Human (GRCh38)
Location 20:34292478-34292500 20:34292515-34292537
Sequence CCTCGTCCGTTTCGCCCTTCCAG GTGAGTGGCACATCAGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 3, 4: 49} {0: 1, 1: 0, 2: 2, 3: 23, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!