ID: 1172364437_1172364444

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1172364437 1172364444
Species Human (GRCh38) Human (GRCh38)
Location 20:34338152-34338174 20:34338181-34338203
Sequence CCCAGTTACTCAGGAGGCTGAGG GATCACGTGACCCCGGGAGGTGG
Strand - +
Off-target summary {0: 2930, 1: 105244, 2: 210342, 3: 240613, 4: 149234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!