ID: 1172364439_1172364444

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1172364439 1172364444
Species Human (GRCh38) Human (GRCh38)
Location 20:34338153-34338175 20:34338181-34338203
Sequence CCAGTTACTCAGGAGGCTGAGGT GATCACGTGACCCCGGGAGGTGG
Strand - +
Off-target summary {0: 563, 1: 16711, 2: 121803, 3: 225359, 4: 238090} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!