ID: 1172411594_1172411599

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1172411594 1172411599
Species Human (GRCh38) Human (GRCh38)
Location 20:34727883-34727905 20:34727909-34727931
Sequence CCTGCTAATTTTTGTCTTTTTAG AGATGGGGGTTTCACCACACTGG
Strand - +
Off-target summary {0: 296, 1: 88338, 2: 74359, 3: 46507, 4: 42146} {0: 2, 1: 35, 2: 215, 3: 1458, 4: 2733}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!