ID: 1172935434_1172935442

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1172935434 1172935442
Species Human (GRCh38) Human (GRCh38)
Location 20:38616757-38616779 20:38616809-38616831
Sequence CCCAGGGAACATTTGGCAAGGTC GGGATGCTTTGGCGTCTAGTGGG
Strand - +
Off-target summary {0: 1, 1: 39, 2: 240, 3: 704, 4: 1198} {0: 1, 1: 0, 2: 1, 3: 8, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!