ID: 1173074853_1173074865

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1173074853 1173074865
Species Human (GRCh38) Human (GRCh38)
Location 20:39808025-39808047 20:39808062-39808084
Sequence CCATTTTCCCCTCTTTCCTACAG TCTGCCCAAGTGGTCAAGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!