ID: 1173193763_1173193769

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1173193763 1173193769
Species Human (GRCh38) Human (GRCh38)
Location 20:40896801-40896823 20:40896824-40896846
Sequence CCCAACTACTTGGGATGCTAAGG TGGCGGGATCACTTGAGCCCAGG
Strand - +
Off-target summary {0: 4, 1: 205, 2: 7780, 3: 116247, 4: 227222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!