ID: 1173249361_1173249364

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1173249361 1173249364
Species Human (GRCh38) Human (GRCh38)
Location 20:41356612-41356634 20:41356628-41356650
Sequence CCTTAGGACAATGTTGACTCAGG ACTCAGGTACCCTGGCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!