ID: 1173482839_1173482841

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1173482839 1173482841
Species Human (GRCh38) Human (GRCh38)
Location 20:43416704-43416726 20:43416721-43416743
Sequence CCTGCAACTGAGAAACAACCCTA ACCCTACAGGTGATCCCTGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!