ID: 1173560857_1173560863

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1173560857 1173560863
Species Human (GRCh38) Human (GRCh38)
Location 20:44004384-44004406 20:44004411-44004433
Sequence CCTGAGGAACCCTAGATGAGAAC AAGGAGAAGGTGAAGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 394} {0: 1, 1: 0, 2: 23, 3: 279, 4: 1866}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!