ID: 1173583870_1173583874

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1173583870 1173583874
Species Human (GRCh38) Human (GRCh38)
Location 20:44166958-44166980 20:44166986-44167008
Sequence CCCTGCCTCATCTTGGACTGCTC TCACACTCGCCTTCCCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 227} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!