ID: 1173649053_1173649058

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1173649053 1173649058
Species Human (GRCh38) Human (GRCh38)
Location 20:44651559-44651581 20:44651573-44651595
Sequence CCCCGCGCGCGCTCACTTTGGGC ACTTTGGGCTTGTCGAAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 31} {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!