ID: 1173679081_1173679084

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1173679081 1173679084
Species Human (GRCh38) Human (GRCh38)
Location 20:44863619-44863641 20:44863650-44863672
Sequence CCAGCACTCCCTCAACACAGGGA ACAAATTTTCCTTTGTTTTATGG
Strand - +
Off-target summary No data {0: 26, 1: 17, 2: 18, 3: 83, 4: 931}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!