ID: 1173679586_1173679593

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1173679586 1173679593
Species Human (GRCh38) Human (GRCh38)
Location 20:44868482-44868504 20:44868530-44868552
Sequence CCATGGGGAATATAGAGCTGGGA GTCCACCTCGAACAGTCATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!