ID: 1173738049_1173738052

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1173738049 1173738052
Species Human (GRCh38) Human (GRCh38)
Location 20:45375551-45375573 20:45375572-45375594
Sequence CCCTGGCAGGGAGAGGAAAGGCA CAGTCAGCACAGCAGGACCGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 64, 4: 511} {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!