ID: 1173763763_1173763767

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1173763763 1173763767
Species Human (GRCh38) Human (GRCh38)
Location 20:45587606-45587628 20:45587625-45587647
Sequence CCTGGGCTACGGCATTCCTTGGC TGGCCTGGTGGCCAGATTTCTGG
Strand - +
Off-target summary No data {0: 155, 1: 186, 2: 345, 3: 97, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!