ID: 1173763763_1173763771

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1173763763 1173763771
Species Human (GRCh38) Human (GRCh38)
Location 20:45587606-45587628 20:45587646-45587668
Sequence CCTGGGCTACGGCATTCCTTGGC GGCACTTGTAGCAAGCTCCTGGG
Strand - +
Off-target summary No data {0: 307, 1: 190, 2: 139, 3: 92, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!