ID: 1173763763_1173763773

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1173763763 1173763773
Species Human (GRCh38) Human (GRCh38)
Location 20:45587606-45587628 20:45587648-45587670
Sequence CCTGGGCTACGGCATTCCTTGGC CACTTGTAGCAAGCTCCTGGGGG
Strand - +
Off-target summary No data {0: 303, 1: 184, 2: 210, 3: 143, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!