ID: 1173884196_1173884199

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1173884196 1173884199
Species Human (GRCh38) Human (GRCh38)
Location 20:46442379-46442401 20:46442415-46442437
Sequence CCAGTGAAGGGCATCTAGATTGT TTATTACAAATAAAGCTGTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 14, 3: 97, 4: 560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!