ID: 1174467795_1174467811

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1174467795 1174467811
Species Human (GRCh38) Human (GRCh38)
Location 20:50731127-50731149 20:50731178-50731200
Sequence CCCGGGGCGGAAACTCCAGCACC TGAAGCGGGGCGGAGGGCCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!