ID: 1174609931_1174609935

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1174609931 1174609935
Species Human (GRCh38) Human (GRCh38)
Location 20:51790684-51790706 20:51790701-51790723
Sequence CCACAGATCTTACACTGGAACGG GAACGGTCTCTCCCCGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 71} {0: 1, 1: 0, 2: 0, 3: 12, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!