ID: 1174882882_1174882892

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1174882882 1174882892
Species Human (GRCh38) Human (GRCh38)
Location 20:54300196-54300218 20:54300240-54300262
Sequence CCTCTGAAGGAAAGAAGGCACAG CAGGGTTTAAGGCAATACATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 364} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!