ID: 1175023209_1175023216

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1175023209 1175023216
Species Human (GRCh38) Human (GRCh38)
Location 20:55873535-55873557 20:55873582-55873604
Sequence CCAGCTTTCAGGCTGCAGGTCCA TGCCAGCGCCCAGGATTCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!