ID: 1175112446_1175112453 |
View in Genome Browser |
Spacer: 12 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1175112446 | 1175112453 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 20:56658139-56658161 | 20:56658174-56658196 |
Sequence | CCTTCAGTCAGGATGGCTGGCCA | AAATGCCTTGGAGGAGGATATGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |