ID: 1175166863_1175166872

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1175166863 1175166872
Species Human (GRCh38) Human (GRCh38)
Location 20:57050144-57050166 20:57050196-57050218
Sequence CCACTTGCTTACCTGTGTGATCT GGTTTCTCCCTGTGCAAAACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!