ID: 1175264076_1175264082

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1175264076 1175264082
Species Human (GRCh38) Human (GRCh38)
Location 20:57692131-57692153 20:57692178-57692200
Sequence CCCAGGACTGAGCTGAGCCCTTG TACGATGCCCCCTGTGTAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 290} {0: 1, 1: 0, 2: 0, 3: 6, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!