ID: 1175378092_1175378102

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1175378092 1175378102
Species Human (GRCh38) Human (GRCh38)
Location 20:58543034-58543056 20:58543085-58543107
Sequence CCAAAGATGATGGTGTCCGTCCC CTTTACTGGAACACAGCCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!