ID: 1175420117_1175420124

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1175420117 1175420124
Species Human (GRCh38) Human (GRCh38)
Location 20:58826542-58826564 20:58826564-58826586
Sequence CCCGGCTTAAACTGTTTAGATCC CTGGATTAGCAGAGGGGACCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!