ID: 1175424054_1175424061

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1175424054 1175424061
Species Human (GRCh38) Human (GRCh38)
Location 20:58853322-58853344 20:58853348-58853370
Sequence CCCTGAAATCGGGGAACAGCCCG AACCACCTTTGGAGGCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40} {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!