ID: 1175424055_1175424060

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1175424055 1175424060
Species Human (GRCh38) Human (GRCh38)
Location 20:58853323-58853345 20:58853347-58853369
Sequence CCTGAAATCGGGGAACAGCCCGA CAACCACCTTTGGAGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35} {0: 1, 1: 0, 2: 1, 3: 12, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!