ID: 1175616512_1175616521

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1175616512 1175616521
Species Human (GRCh38) Human (GRCh38)
Location 20:60404604-60404626 20:60404641-60404663
Sequence CCTGTAATCCCAGCTACTGGAGA ATAAGTTGAACCTGGGAAGCGGG
Strand - +
Off-target summary {0: 295, 1: 9238, 2: 119517, 3: 266931, 4: 249395} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!