ID: 1175616513_1175616521 |
View in Genome Browser |
Spacer: 6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1175616513 | 1175616521 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 20:60404612-60404634 | 20:60404641-60404663 |
| Sequence | CCCAGCTACTGGAGAAGCTGAGG | ATAAGTTGAACCTGGGAAGCGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 32, 3: 496, 4: 1876} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||