ID: 1175816951_1175816961

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1175816951 1175816961
Species Human (GRCh38) Human (GRCh38)
Location 20:61888156-61888178 20:61888185-61888207
Sequence CCACATCCCTGCAGAGCCGCCGC CGGTACACACAGATGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 230} {0: 1, 1: 0, 2: 0, 3: 13, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!