ID: 1175888561_1175888574

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1175888561 1175888574
Species Human (GRCh38) Human (GRCh38)
Location 20:62305932-62305954 20:62305966-62305988
Sequence CCCCATTTGTGAAATGGGCGGAG ACACCCGGGATTGCGGCGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 84, 4: 633} {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!