ID: 1175983647_1175983662

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1175983647 1175983662
Species Human (GRCh38) Human (GRCh38)
Location 20:62753716-62753738 20:62753762-62753784
Sequence CCATTGATGGCTGTTATTCCACT CTCCATTGGAAGCCGGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 183} {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!