ID: 1176015525_1176015541

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1176015525 1176015541
Species Human (GRCh38) Human (GRCh38)
Location 20:62929308-62929330 20:62929337-62929359
Sequence CCTTTGGGAGGGGAGCAGCGGGG CACGGGGAGGGGCGAGGGCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 76, 4: 877}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!