ID: 1176175445_1176175450

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1176175445 1176175450
Species Human (GRCh38) Human (GRCh38)
Location 20:63721072-63721094 20:63721096-63721118
Sequence CCGGGCGCAGTGGCTCACGCCTG AATGCTAGGACTTTGGGAAGTGG
Strand - +
Off-target summary {0: 9533, 1: 58782, 2: 109662, 3: 131093, 4: 137784} {0: 1, 1: 1, 2: 30, 3: 679, 4: 5227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!