ID: 1176206522_1176206534

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1176206522 1176206534
Species Human (GRCh38) Human (GRCh38)
Location 20:63891624-63891646 20:63891674-63891696
Sequence CCGCACCCTTGGGAGAGGCAGGC GGTCCTCAATGCTGGGACAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 274} {0: 1, 1: 0, 2: 0, 3: 5, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!