ID: 1176264181_1176264191

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1176264181 1176264191
Species Human (GRCh38) Human (GRCh38)
Location 20:64200113-64200135 20:64200158-64200180
Sequence CCTCTGTCCTGGCCCCATCATGT GACACGGATGTGCCTACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 319} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!