ID: 1176264184_1176264191

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1176264184 1176264191
Species Human (GRCh38) Human (GRCh38)
Location 20:64200125-64200147 20:64200158-64200180
Sequence CCCCATCATGTGGCGCACCAGCA GACACGGATGTGCCTACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53} {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!