ID: 1176274176_1176274180

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1176274176 1176274180
Species Human (GRCh38) Human (GRCh38)
Location 20:64254556-64254578 20:64254582-64254604
Sequence CCATGGATCAACAAGAGAAGTGA CTCCCTGGGACCACATAACGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!