ID: 1176298823_1176298828

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1176298823 1176298828
Species Human (GRCh38) Human (GRCh38)
Location 21:5088850-5088872 21:5088880-5088902
Sequence CCTGCCTCTGCCTCCGTTTCTGC GCCTGCCGGACTCCAGCCCGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 10, 3: 130, 4: 1330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!