ID: 1176460561_1176460566

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1176460561 1176460566
Species Human (GRCh38) Human (GRCh38)
Location 21:7004378-7004400 21:7004424-7004446
Sequence CCTCGGCACAGTCACCTGTAGTG AAGTAGACACAAATCCCCATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!