|
Left Crispr |
Right Crispr |
| Crispr ID |
1176596842 |
1176596844 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
21:8705524-8705546
|
21:8705542-8705564
|
| Sequence |
CCTAGAAAGGGGCTGTAGTGCTT |
TGCTTCAGCTGTCCACTTTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 20, 1: 171, 2: 206, 3: 178, 4: 219} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|