ID: 1176718824_1176718831

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1176718824 1176718831
Species Human (GRCh38) Human (GRCh38)
Location 21:10377298-10377320 21:10377321-10377343
Sequence CCTGACCCCAGGTGATATGTCTG CCTTGGCCTCCCAAAGTGTTGGG
Strand - +
Off-target summary No data {0: 6703, 1: 100902, 2: 223602, 3: 235479, 4: 140081}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!