ID: 1176718824_1176718836

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1176718824 1176718836
Species Human (GRCh38) Human (GRCh38)
Location 21:10377298-10377320 21:10377348-10377370
Sequence CCTGACCCCAGGTGATATGTCTG CAGGTGTGAGCCACTGTGCTCGG
Strand - +
Off-target summary No data {0: 308, 1: 7224, 2: 29219, 3: 75558, 4: 130919}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!