ID: 1176718825_1176718833

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1176718825 1176718833
Species Human (GRCh38) Human (GRCh38)
Location 21:10377303-10377325 21:10377329-10377351
Sequence CCCCAGGTGATATGTCTGCCTTG TCCCAAAGTGTTGGGATGACAGG
Strand - +
Off-target summary No data {0: 215, 1: 25122, 2: 318955, 3: 254659, 4: 134873}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!